Papers - SUGIMOTO Naoki
-
Liquid-Liquid Phase Separation and Nucleic Acids
Hisae Tateishi-Karimata, Saki Matsumoto, Naoki Sugimoto
Handbook of Chemical Biology of Nucleic Acids 1 - 40 2023
Publisher:Springer Nature Singapore
DOI: 10.1007/978-981-16-1313-5_90-1
Other Link: https://kaken.nii.ac.jp/grant/KAKENHI-PROJECT-21K14742/
-
Cladogenetic Orthogonal Light-Up Aptamers for Simultaneous Detection of Multiple Small Molecules in Cells Reviewed International coauthorship International journal
T. Endoh, J. H. Tan, S. B. Chen, and N. Sugimoto
Anal. Chem. 95 976 - 985 2022.12
Recent successes in construction of light-up RNA aptamers allowed fluorescence-based live-cell imaging of RNAs. In addition, light-up aptamers have been converted into signaling aptamers that enable fluorometric detection of small chemicals. To date, only a single target chemical has been detected at a time in cells. In this study, we selected cladogenetic orthogonal light-up aptamers that output three different colors from the RNA library having the same ligand binding core. Two of the three functioned in mammalian cells. These two aptamers, which fluoresce blue and green upon binding of cognate fluorogen, were converted into signaling aptamers. Using these signaling aptamers in combination with a previously described light-up aptamer with red fluorescence, we demonstrated simultaneous detection of multiple chemicals in living cells. The cladogenetic orthogonal light-up aptamers developed in this study and the simple strategy for rational designing of the signaling aptamers will provide innovative advances in the field of RNA-based bioimaging.
-
High-temperature adaptation of an OsNRT2.3 allele is thermoregulated by small RNAs Reviewed International coauthorship International journal
Y. Zhang, H. Tateishi-Karimata, T. Endoh, Q. J., Kexin Li, X. Fan, Y. Ma, L. Gao, H. Lu, Z. Wang, A. E. Cho, X. Yao, Ch. Liu, N. Sugimoto, S. Guo, X. Fu, Q. Shen, G. Xu, L. R. Herrera-Estrella, X. Fan
Science Advances 8 9785 2022.11
-
Controlling liquid-liquid phase separation of G-quadruplex-forming RNAs in a sequence-specific manner. Reviewed International journal
Mitsuki Tsuruta, Takeru Torii, Kazuki Kohata, Keiko Kawauchi, Hisae Tateishi-Karimata, Naoki Sugimoto, Daisuke Miyoshi
Chemical communications (Cambridge, England) 58 ( 93 ) 12931 - 12934 2022.11
We constructed a minimum liquid-liquid phase separation model system to form liquid droplets using only G-quadruplex-forming oligonucleotides and R- and G-rich oligopeptides. We found that the G-quadruplex structure is an essential component for RNA to form droplets with the peptide. Based on this model system and our findings, droplet redissolution via structure transition from a G-quadruplex to a duplex was achieved in a sequence-specific manner.
Liquid–liquid phase separation (LLPS) of biomacromolecules has been attracting attention as a novel phenomenon and a new phase in living cells.1 It is now evident that LLPS involving nucleic acids participates in the regulation of gene expression at various levels, including replication, transcription, RNA processing, localization, and translation.2 Dysfunction of LLPS is linked to the onset of viral infection,3 cancer,4 and neurodegenerative diseases.2 Although LLPS is induced by different molecular compositions, it is considered that LLPS of different molecular compositions has common assembly and disassembly mechanisms.5 Many of the protein motifs essential for LLPS are intrinsically disordered regions (IDRs) such as RGG motifs.6 Moreover, databases and prediction models of proteins undergoing LLPS have been established.7 Furthermore, fundamental properties of RNAs for inducing LLPS is becoming clear.8–11 RNA secondary structure-dependent LLPS has also been reported.12
Of note, the RGG domain derived from various RNA binding proteins (RBPs) selectively binds with G-quadruplexes (G4s), a non-canonical secondary structure of nucleic acids.13 G4 formed by guanine-rich sequences have been reported to induce LLPS in a structure-specific manner. Fragile X mental retardation protein (FMRP),14 SERPINE1 mRNA-binding protein 1 (SERBP1),15 and Histone H116 all induce LLPS with G4. The repetitive GGGGCC sequence, found within the C9orf72 gene, undergoes pathogenic expansion responsible for amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).17 Repetitive expansion of GGC repeats on the FMR1 gene is considered as an onset mechanism of neurodegenerative diseases such as fragile X syndrome (FXS) and fragile X-associated tremor/ataxia syndrome (FXTAS).18 These sequences can fold to form G4 structures and induce aberrant RNA foci in the nucleus through sequestration of various RBPs.19 Although the characteristics of the various protein and nucleic acid sequences of droplets are becoming clearer, methods for regulating droplets have not yet been developed. Here, we developed a model system of LLPS based on oligonucleotides and oligopeptides to investigate the essential properties of RNA that directly induce and control LLPS.
A series of RNA oligonucleotides were designed to study their ability to undergo LLPS with a cationic peptide containing the RGG motif derived from FMRP (Table 1).13 FMR1 RNA and C9orf72 RNA are four repeats of GGC and GGGGCC, respectively, which may form a G4. sFMR1 RNA is a scrambled sequence of FMR1 RNA that does not form a G4. Comp-RNA is complementary to FMR1 RNA. dsRNA was designed to form an intramolecular duplex (a hairpin loop structure). The structure of the RNA oligonucleotides was studied by CD spectroscopy and UV melting curves (Fig. S1, ESI†). These results are consistent with each other and show that FMR1 RNA and c9orf72 RNA fold into parallel G4s, and the 1 : 1 mixture and dsRNA forms A-form duplexes in the experimental conditions. (See Fig. S1, ESI† for explanations of the CD spectra and UV melting curves).DOI: 10.1039/d2cc04366a
-
DNA methylation is regulated by both the stability and topology of G-quadruplex Reviewed International journal
S. Matsumoto, H. Tateishi-Karimata, N. Sugimoto
Chem. Commun., 58 12459 - 12462 2022.10
DOI: 10.1039/d2cc04383a
-
Volumetric strategy for quantitatively elucidating local hydration network around a G-quadruplex Reviewed International coauthorship International journal
S. Matsumoto, S. Takahashi, S. Bhowmik, T. Ohyama, and N. Sugimoto
Anal. Chem 94 ( Selected as a Supplemental Cover ) 7400 - 7407 2022.5
Authorship:Last author
Hydration around nucleic acids, such as DNA and RNA, is an important factor not only for the stability of nucleic acids but also for their interaction with binding molecules. Thus, it is necessary to quantitatively elucidate the hydration properties of nucleic acids around a certain structure. In this study, volumetric changes in G-quadruplex (G4) RNA formation were investigated by systematically changing the number of G-quartet stacks under high pressure. The volumetric contribution at the level of each G4 structural unit revealed that the core G4 helix was significantly more dehydrated than the other parts, including the edges of G-quartets and loops. These findings will help in predicting the binding of G4 ligands on the surface of G4, depending on the chemical structure of the ligand and solution environment. Therefore, the preset volumetric parameter provides information that can predict molecular interactions in G4 formations during molecular crowding in cells.
-
Applicability of Nearest-neighbour Model for Pseudoknot RNAs Reviewed International journal
S. Satpathi, T. Endoh, and N. Sugimoto
Chem. Commun 58 ( [Selected as an Inside Back Cover] ) 5952 - 5955 2022.4
Authorship:Last author
DOI: 10.1039/d1cc07094k
-
Replication Control of Human Telomere G-Quadruplex DNA by G-Quadruplex Ligands Dependent on Solution Environment Reviewed International journal
S. Takahashi, S. Bhowmik, S. Sato, S. Takenaka, and N. Sugimoto
Life 12 ( 4 ) 553 2022.4
Authorship:Last author
The human telomere region is known to contain guanine-rich repeats and form a guanine-quadruplex (G4) structure. As telomeres play a role in the regulation of cancer progression, ligands that specifically bind and stabilize G4 have potential therapeutic applications. However, as the human telomere sequence can form G4 with various topologies due to direct interaction by ligands and indirect interaction by the solution environment, it is of great interest to study the topology-dependent control of replication by ligands. In the present study, a DNA replication assay of a template with a human telomere G4 sequence in the presence of various ligands was performed. Cyclic naphthalene diimides (cNDI1 and cNDI2) efficiently increased the replication stall of the template DNA at G4 with an anti-parallel topology. This inhibition was stability-dependent and topology-selective, as the replication of templates with hybrid or parallel G4 structures was not affected by the cNDI and cNDI2. Moreover, the G4 ligand fisetin repressed replication with selectivity for anti-parallel and hybrid G4 structures without stabilization. Finally, the method used, referred to as quantitative study of topology-dependent replication (QSTR), was adopted to evaluate the correlation between the replication kinetics and the stability of G4. Compared to previous results obtained using a modified human telomere sequence, the relationship between the stability of G4 and the effect on the topology-dependent replication varied. Our results suggest that native human telomere G4 is more flexible than the modified sequence for interacting with ligands. These findings indicate that the modification of the human telomeric sequence forces G4 to rigidly form a specific structure of G4, which can restrict the change in topology-dependent replication by some ligands.
DOI: 10.3390/life12040553
-
Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex Reviewed International coauthorship International journal
Kane T. McQuaid, Shuntaro Takahashi, Lena Baumgaertner, David J. Cardin, Neil G. Paterson, James P. Hall, Naoki Sugimoto, and Christine J. Cardin
Journal of the American Chemical Society 144 ( 13 ) 5956 - 5964 2022.4
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
-
Thermodynamic Analysis to Elucidate the Behaviors Reviewed International journal
S. Takahashi, N.Sugimoto
49 14 - 19 2022.1
Joint Work
The folding and unfolding of nucleic acids (DNA and RNA) are essential for these functions in cells.
These behaviours are also widely used for various technical applications using nucleic acids. To understand the biological mechanism of nucleic acids function and design materials of nucleic acids, the biophysical approach using thermodynamics is highly useful and important. The stability prediction of duplexes of nucleic acids have been developed and widely used. However, it has been also noted that such predictions cannot be always adopted to prediction in various solution conditions, especially the cellular conditions, because the concentrations of cations and cosolutes in the intracellular condition termed molecular crowding are different from those in the standard experimental condition.
Moreover, the crowding condition in cells is spatiotemporally variable. Therefore, it is highly demanded to establish the prediction method available in cellular conditions for the stability of various structures of nuclei acids. This article reviews the biophysicochemical background predicting nucleic acids stability and our recent studies for the prediction of these stability in the cellular conditions.
Keywords: nucleic acids, thermodynamics, duplex, stability prediction, molecular crowding, intracellular condition. -
Dielectricity of a molecularly crowded solution accelerates NTP misincorporation during RNA-dependent RNA polymerization by T7 RNA polymerase Reviewed International journal
S. Takahashi, S. Matsumoto, P. Chilka, S. Ghosh, H. Okura, and N. Sugimoto
Scientific reports 12 1149 2022.1
Authorship:Last author
In biological systems, the synthesis of nucleic acids, such as DNA and RNA, is catalyzed by enzymes in various aqueous solutions. However, substrate specificity is derived from the chemical properties of the residues, which implies that perturbations of the solution environment may cause changes in the fidelity of the reaction. Here, we investigated non-promoter-based synthesis of RNA using T7 RNA polymerase (T7 RNAP) directed by an RNA template in the presence of polyethylene glycol (PEG) of various molecular weights, which can affect polymerization fidelity by altering the solution properties. We found that the mismatch extensions of RNA propagated downstream polymerization. Furthermore, PEG promoted the polymerization of non-complementary ribonucleoside triphosphates, mainly due to the decrease in the dielectric constant of the solution. These results indicate that the mismatch extension of RNA-dependent RNA polymerization by T7 RNAP is driven by the stacking interaction of bases of the primer end and the incorporated nucleotide triphosphates (NTP) rather than base pairing between them. Thus, proteinaceous RNA polymerase may display different substrate specificity with changes in dielectricity caused by molecular crowding conditions, which can result in increased genetic diversity without proteinaceous modification.
-
Effect of DNA modifications on the transition bet and non-canoncial DNA stransures in CpG islands during senescence Reviewed International journal
S.Matsumoto, H. Tateishi-Karimata, T. Ohyama, and N. Sugimoto
RSC Advances 11 37205 - 37217 2021.12
Joint Work
-
Intramolecular G-quadruplex-hairpin loop structure competition of a GC-rich exon region in the TMPRSS2 gen Reviewed International journal
W. Sugimoto, N. Kinoshita, M. Nakata, T. Ohyama, H. Tateishi-Karimata, T. Nishikata, N. Sugimoto, D. Miyoshi, and K. Kawauchi
Chem. Commun. 58 48 - 51 2021.11
Joint Work
DOI: 10.1039/d1cc05523b
-
Correction to 'Improved nearest-neighbor parameters for the stability of RNA/DNA hybrids under a physiological condition'. Reviewed International journal
Dipanwita Banerjee, Hisae Tateishi-Karimata, Tatsuya Ohyama, Saptarshi Ghosh, Tamaki Endoh, Shuntaro Takahashi, Naoki Sugimoto
Nucleic acids research 49 ( 18 ) 10796 - 10799 2021.10
The stability of Watson–Crick paired RNA/DNA hybrids is important for designing optimal oligonucleotides for ASO (Antisense Oligonucleotide) and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas9 techniques. Previous nearest-neighbour (NN) parameters for predicting hybrid stability in a 1 M NaCl solution, however, may not be applicable for predicting stability at salt concentrations closer to physiological condition (e.g. ∼100 mM Na+ or K+ in the presence or absence of Mg2+). Herein, we report measured thermodynamic parameters of 38 RNA/DNA hybrids at 100 mM NaCl and derive new NN parameters to predict duplex stability. Predicted ΔG°37 and Tm values based on the established NN parameters agreed well with the measured values with 2.9% and 1.1°C deviations, respectively. The new results can also be used to make precise predictions for duplexes formed in 100 mM KCl or 100 mM NaCl in the presence of 1 mM Mg2+, which can mimic an intracellular and extracellular salt condition, respectively. Comparisons of the predicted thermodynamic parameters with published data using ASO and CRISPR–Cas9 may allow designing shorter oligonucleotides for these techniques that will diminish the probability of non-specific binding and also improve the efficiency of target gene regulation.
DOI: 10.1093/nar/gkab780
-
Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding Reviewed International journal
高橋 俊太郎, 建石 寿枝, 杉本 直己
Journal of the American Chemical Society 143 16458 - 16469 2021.9
-
Transcriptome screening followed by integrated physicochemical and structural analyses for investigating RNA-mediated berberine activity Reviewed International coauthorship International journal
S.Satopathi, T.Endoh, Peter Podbevˇsek, Janez Plavec, N. Sugimoto
Nucleic acids research 49 8449 - 8461 2021.9
-
Triple-Helical Binding of Peptide Nucleic Acid Inhibits Maturation of Endogenous MicroRNA-197 Reviewed International coauthorship International journal
遠藤 玉樹, 杉本 直己
ACS Chemical biology 16 1147 - 1151 2021.7
-
Chemical Biology of Double Helical and Non-Double Helical Nucleic Acids: “To B or Not To B, That Is the Question” Reviewed International journal
N. Sugimoto, T. Endoh, S. Takahashi, H. Tateishi-Karimata
Bulletin of the Chemical Society of Japan 94 1970 - 1998 2021.7
-
Enhancement of the Catalytic Activity of Hammerhead Ribozymes by Organic Cations. Reviewed International journal
Shu-Ichi Nakano, Hirofumi Yamashita, Naoki Sugimoto
Chembiochem : a European journal of chemical biology 2021.7
Catalytic turnover is important for the application of ribozymes to biotechnology. However, the turnover is often impaired because of the intrinsic high stability of base pairs with cleaved RNA products. Here, organic cations were used as additives to improve the catalytic performance of hammerhead ribozyme constructs that exhibit different kinetic behaviors. Kinetic analysis of substrate cleavage demonstrated that bulky cations, specifically tetra-substituted ammonium ions containing pentyl groups or a benzyl group, have the ability to greatly increase the turnover rate of the ribozymes. Thermal stability analysis of RNA structures revealed that the bulky cations promote the dissociation of cleaved products and refolding of incorrectly folded structures with small disruption of the catalytic structure. The use of bulky cations is a convenient method for enhancing the catalytic activity of hammerhead ribozymes, and the approach may be useful for advancing ribozyme technologies.
-
New Insights into the Functions of Nucleic Acids Controlled by Cellular Microenvironments Topics in Current Chemistry Reviewed International journal
S.Matsumoto, N.Sugimoto
Topics in Current Chemistry 379 2021.6