Papers - SUGIMOTO Naoki
-
Replication Control of Human Telomere G-Quadruplex DNA by G-Quadruplex Ligands Dependent on Solution Environment Reviewed International journal
S. Takahashi, S. Bhowmik, S. Sato, S. Takenaka, and N. Sugimoto
Life 12 ( 4 ) 553 2022.4
Authorship：Last author
The human telomere region is known to contain guanine-rich repeats and form a guanine-quadruplex (G4) structure. As telomeres play a role in the regulation of cancer progression, ligands that specifically bind and stabilize G4 have potential therapeutic applications. However, as the human telomere sequence can form G4 with various topologies due to direct interaction by ligands and indirect interaction by the solution environment, it is of great interest to study the topology-dependent control of replication by ligands. In the present study, a DNA replication assay of a template with a human telomere G4 sequence in the presence of various ligands was performed. Cyclic naphthalene diimides (cNDI1 and cNDI2) efficiently increased the replication stall of the template DNA at G4 with an anti-parallel topology. This inhibition was stability-dependent and topology-selective, as the replication of templates with hybrid or parallel G4 structures was not affected by the cNDI and cNDI2. Moreover, the G4 ligand fisetin repressed replication with selectivity for anti-parallel and hybrid G4 structures without stabilization. Finally, the method used, referred to as quantitative study of topology-dependent replication (QSTR), was adopted to evaluate the correlation between the replication kinetics and the stability of G4. Compared to previous results obtained using a modified human telomere sequence, the relationship between the stability of G4 and the effect on the topology-dependent replication varied. Our results suggest that native human telomere G4 is more flexible than the modified sequence for interacting with ligands. These findings indicate that the modification of the human telomeric sequence forces G4 to rigidly form a specific structure of G4, which can restrict the change in topology-dependent replication by some ligands.
DOI： 10.3390/life12040553
-
Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex Reviewed International coauthorship International journal
Kane T. McQuaid, Shuntaro Takahashi, Lena Baumgaertner, David J. Cardin, Neil G. Paterson, James P. Hall, Naoki Sugimoto, and Christine J. Cardin
Journal of the American Chemical Society 144 ( 13 ) 5956 - 5964 2022.4
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
-
Thermodynamic Analysis to Elucidate the Behaviors Reviewed International journal
S. Takahashi, N.Sugimoto
49 14 - 19 2022.1
Joint Work
The folding and unfolding of nucleic acids (DNA and RNA) are essential for these functions in cells.
These behaviours are also widely used for various technical applications using nucleic acids. To understand the biological mechanism of nucleic acids function and design materials of nucleic acids, the biophysical approach using thermodynamics is highly useful and important. The stability prediction of duplexes of nucleic acids have been developed and widely used. However, it has been also noted that such predictions cannot be always adopted to prediction in various solution conditions, especially the cellular conditions, because the concentrations of cations and cosolutes in the intracellular condition termed molecular crowding are different from those in the standard experimental condition.
Moreover, the crowding condition in cells is spatiotemporally variable. Therefore, it is highly demanded to establish the prediction method available in cellular conditions for the stability of various structures of nuclei acids. This article reviews the biophysicochemical background predicting nucleic acids stability and our recent studies for the prediction of these stability in the cellular conditions.
Keywords: nucleic acids, thermodynamics, duplex, stability prediction, molecular crowding, intracellular condition. -
Dielectricity of a molecularly crowded solution accelerates NTP misincorporation during RNA-dependent RNA polymerization by T7 RNA polymerase Reviewed International journal
S. Takahashi, S. Matsumoto, P. Chilka, S. Ghosh, H. Okura, and N. Sugimoto
Scientific reports 12 1149 2022.1
Authorship：Last author
In biological systems, the synthesis of nucleic acids, such as DNA and RNA, is catalyzed by enzymes in various aqueous solutions. However, substrate specificity is derived from the chemical properties of the residues, which implies that perturbations of the solution environment may cause changes in the fidelity of the reaction. Here, we investigated non-promoter-based synthesis of RNA using T7 RNA polymerase (T7 RNAP) directed by an RNA template in the presence of polyethylene glycol (PEG) of various molecular weights, which can affect polymerization fidelity by altering the solution properties. We found that the mismatch extensions of RNA propagated downstream polymerization. Furthermore, PEG promoted the polymerization of non-complementary ribonucleoside triphosphates, mainly due to the decrease in the dielectric constant of the solution. These results indicate that the mismatch extension of RNA-dependent RNA polymerization by T7 RNAP is driven by the stacking interaction of bases of the primer end and the incorporated nucleotide triphosphates (NTP) rather than base pairing between them. Thus, proteinaceous RNA polymerase may display different substrate specificity with changes in dielectricity caused by molecular crowding conditions, which can result in increased genetic diversity without proteinaceous modification.
-
Effect of DNA modifications on the transition bet and non-canoncial DNA stransures in CpG islands during senescence Reviewed International journal
S.Matsumoto, H. Tateishi-Karimata, T. Ohyama, and N. Sugimoto
RSC Advances 11 37205 - 37217 2021.12
Joint Work
-
Intramolecular G-quadruplex-hairpin loop structure competition of a GC-rich exon region in the TMPRSS2 gen Reviewed International journal
W. Sugimoto, N. Kinoshita, M. Nakata, T. Ohyama, H. Tateishi-Karimata, T. Nishikata, N. Sugimoto, D. Miyoshi, and K. Kawauchi
Chem. Commun. 58 48 - 51 2021.11
Joint Work
DOI： 10.1039/d1cc05523b
-
Correction to 'Improved nearest-neighbor parameters for the stability of RNA/DNA hybrids under a physiological condition'. Reviewed International journal
Dipanwita Banerjee, Hisae Tateishi-Karimata, Tatsuya Ohyama, Saptarshi Ghosh, Tamaki Endoh, Shuntaro Takahashi, Naoki Sugimoto
Nucleic acids research 49 ( 18 ) 10796 - 10799 2021.10
The stability of Watson–Crick paired RNA/DNA hybrids is important for designing optimal oligonucleotides for ASO (Antisense Oligonucleotide) and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas9 techniques. Previous nearest-neighbour (NN) parameters for predicting hybrid stability in a 1 M NaCl solution, however, may not be applicable for predicting stability at salt concentrations closer to physiological condition (e.g. ∼100 mM Na+ or K+ in the presence or absence of Mg2+). Herein, we report measured thermodynamic parameters of 38 RNA/DNA hybrids at 100 mM NaCl and derive new NN parameters to predict duplex stability. Predicted ΔG°37 and Tm values based on the established NN parameters agreed well with the measured values with 2.9% and 1.1°C deviations, respectively. The new results can also be used to make precise predictions for duplexes formed in 100 mM KCl or 100 mM NaCl in the presence of 1 mM Mg2+, which can mimic an intracellular and extracellular salt condition, respectively. Comparisons of the predicted thermodynamic parameters with published data using ASO and CRISPR–Cas9 may allow designing shorter oligonucleotides for these techniques that will diminish the probability of non-specific binding and also improve the efficiency of target gene regulation.
DOI： 10.1093/nar/gkab780
-
Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding Reviewed International journal
高橋 俊太郎, 建石 寿枝, 杉本 直己
Journal of the American Chemical Society 143 16458 - 16469 2021.9
-
Transcriptome screening followed by integrated physicochemical and structural analyses for investigating RNA-mediated berberine activity Reviewed International coauthorship International journal
S.Satopathi, T.Endoh, Peter Podbevˇsek, Janez Plavec, N. Sugimoto
Nucleic acids research 49 8449 - 8461 2021.9
-
Triple-Helical Binding of Peptide Nucleic Acid Inhibits Maturation of Endogenous MicroRNA-197 Reviewed International coauthorship International journal
遠藤 玉樹, 杉本 直己
ACS Chemical biology 16 1147 - 1151 2021.7
-
Chemical Biology of Double Helical and Non-Double Helical Nucleic Acids: “To B or Not To B, That Is the Question” Reviewed International journal
N. Sugimoto, T. Endoh, S. Takahashi, H. Tateishi-Karimata
Bulletin of the Chemical Society of Japan 94 1970 - 1998 2021.7
-
Enhancement of the Catalytic Activity of Hammerhead Ribozymes by Organic Cations. Reviewed International journal
Shu-Ichi Nakano, Hirofumi Yamashita, Naoki Sugimoto
Chembiochem : a European journal of chemical biology 2021.7
Catalytic turnover is important for the application of ribozymes to biotechnology. However, the turnover is often impaired because of the intrinsic high stability of base pairs with cleaved RNA products. Here, organic cations were used as additives to improve the catalytic performance of hammerhead ribozyme constructs that exhibit different kinetic behaviors. Kinetic analysis of substrate cleavage demonstrated that bulky cations, specifically tetra-substituted ammonium ions containing pentyl groups or a benzyl group, have the ability to greatly increase the turnover rate of the ribozymes. Thermal stability analysis of RNA structures revealed that the bulky cations promote the dissociation of cleaved products and refolding of incorrectly folded structures with small disruption of the catalytic structure. The use of bulky cations is a convenient method for enhancing the catalytic activity of hammerhead ribozymes, and the approach may be useful for advancing ribozyme technologies.
-
New Insights into the Functions of Nucleic Acids Controlled by Cellular Microenvironments Topics in Current Chemistry Reviewed International journal
S.Matsumoto, N.Sugimoto
Topics in Current Chemistry 379 2021.6
-
Artificial turn-on riboswitch to control target gene expression using a wild-type riboswitch splicing mechanism Reviewed International journal
T. Yamauchi, T. Kubodera, D. Miyoshi, N. Sugimoto, and S. Hirohata
Journal of Bioscience and Bioengineering 131 115 - 123 2021.2
Joint Work
-
Combined Effects of Methylated Cytosine and Molecular Crowding on the Thermodynamic Stability of DNA Duplexes Reviewed International journal
M. Tsuruta, Y. Sugitani, N. Sugimoto, D. Miyoshi
Int. J. Mol. Sci., 22 947 2021.1
Joint Work
DOI： 10.3390/ijms22020947
-
Engineering exosome polymer hybrids by atom transfer radical polymerization Reviewed International coauthorship International journal
S. Lathwal, S. S. Yerneni, S. Boye, U. L. Muza, S. Takahashi, N. Sugimoto, A. Lederer, S. R. Das, P. G. Campbell, K. Matyjaszewski
Proc. Natl. Acad. Sci. U. S. A., 118 e2020241118 2021.1
Joint Work
-
Effects of Modifying Thioflavin T at the N3-Position on Its G4 Binding and Fluorescence Emission Reviewed International journal
Y. Kataoka, H. Fujita, T. Endoh, N. Sugimoto, and M. Kuwahara
Molecules 25 ( 21 ) 4936 2020.10
Joint Work
Publisher：MDPI
-
Effect of Molecular Crowding on DNA Polymerase Reactions along Unnatural DNA Templates Reviewed International coauthorship International journal
S. Takahashi, P. Herdwijn, and N. Sugimoto
Molecules 25 ( 18 ) 4120 2020.9
Joint Work
-
Molecular crowding induces primer extension by RNA polymerase through base stacking beyond Watson–Crick rules Reviewed International journal
S. Takahashi, H. Okura, P. Chilika, S. Ghosh, and N. Sugimoto
RSC Advances 10 33052 - 33058 2020.9
Joint Work
[Selected as a HOT Article]
-
Effect of molecular crowding on the stability of RNA G-quadruplexes with various numbers of quartets and lengths of loops Reviewed International journal
S. Matsumoto, H. Takeishi-Karimata, S. Takahashi, T. Ohyama, and N. Sugimoto
Biochemistry 59 ( 28 ) 2640 - 2649 2020.7
Joint Work
[Selected as a Supplemental Cover]